Words similar to ate s
- atassi
- ataturk
- atatürk
- ataxia
- ataxia-oculomotor
- ataxin-
- atcc
- atcgaactggtgtgtcgaagg
- atcisdb
- atctcgaaggagattgttatagg-
- ate
- ate s
- atef
- atelectasis
- atelectatic
- ateliers
- aten
- atención
- atenolol
- atf
- atfalati
- rëévé
- rëéç
- rìnèiwă
- rós
- rózsadomb
- römische
- rāp
- rōta
- rα
- rβ
- s
- s on c-spa
- s time
- s wa
- s, d
- s-
- s--
- s-b
- s-bahn
- s-et
Example sentences for: ate s
How can you use “ate s” in a sentence? Here are some example sentences to help you improve your vocabulary:
Instead, the disease was found in the mid-1990s to be capable of killing humans who ate tainted beef.
Off Grafton Street is Kehoe’s (South Anne Street), a favorite watering spot; and on Duke Street are two pubs with with Ulysses connections — Davy Byrne’s, where Leopold Bloom ate a gorgonzola sandwich and drank a glass of wine, and Bailey’s, a busy, trendy pub on the site of Leopold Bloom’s house.
We recalculated the likelihoods for all QuartOPs in genome quartet #8 using a model that incorporates a mong s ite r ate v ariation (ASRV).
Loading...